Effect of peptide functionalization on nanoparticle transport across brain endothelium in a microfluidic chip

Despite the effort of medicine, many potential drugs, during the development for clinical use, prove not to be able in achieving the central nervous system (CNS), due to the low permeability of the blood-brain barrier (BBB). In consequence, most CNS diseases are untreated. For that reason, there is an increasing interest towards nanotechnology applied to medicine in order to improve the treatments of brain diseases. An important field of nanotechnology applications to CNS is the development of nano-tools for drugs delivering, such as nanoparticles (NPs). In recent years, researchers have been working on several strategies to deliver drugs into the brain. They take advantage of the chance to modulate the chemical-physical surface properties of NPs, improving cell-NP interaction in order to adsorb, to carry compounds and to enhance drug delivery across the BBB. Nevertheless, current drug delivery systems are still associated with the low efficiency of targeting and crossing of the BBB. In this work, peptide functionalized NPs have been synthesized and characterized in order to target and cross the cerebral endothelium. The iron-mimicry moiety CRTIGPSVC (CRT) has been chosen as BBB targeting peptide, exploiting its ability to recognize the transferrin receptor overexpressed on the brain endothelium. Staquicini et al. reported the advanced specific transport ability of CRT through the BBB. Therefore in this work, biocompatible NPs made up of poly (D,L-lactic-co-glycolic acid) (PLGA)-block-polyethylene glycol (PEG) copolymer (namely PELGA) and functionalized with CRT has been synthesized and characterized. The behavior in targeting and transport ability of the NPs in mouse brain endothelial cells has been investigated, under flow conditions. In order to improve the translocation across the BBB, decreasing the lysosomal storage of CRT-NPs, gH625 peptide has been chosen as cell-penetrating peptide (CPP). gH625 is a membranotropic peptide, well known for its ability to penetrate cell membranes and transport a large variety of cargo molecules/materials inside the cells. We speculated that the conjugation of CRT and gH625 to nanoparticle, may improves its translocation efficiency across the BBB. To test this hypothesis, PELGA NPs functionalized with CRT targeting peptide and with the CPP gH625 has been designed. NP efficiency to target the BBB under static and flow conditions and to penetrate across the in vitro BBB has been evaluated. Results demonstrated the cooperative effect of NP functionalization with gH625 and CRT 1:2 in static and flow conditions with a relevant impact on NP transport across the cerebral endothelium. In order to investigate the effect of functionalized NP on transport across the cerebral endothelium, a flow-based in vitro BBB on chip has been engineered. The system more closely mimics in vivo environment and represents a valid BBB in vitro model since exerts the barrier function. Therefore, a study platform for drug delivery systems has been developed. The BBB model system is able to investigate the effects of dynamic conditions on specific targeting and transport across the brain endothelium of active molecules conjugated to nanocarriers

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic

Design and Synthesis of a cADPR Mimic as a Novel Tool for Monitoring the Intracellular Ca2+ Concentration

Cyclic ADP-ribose (cADPR, 1, Figure 1) is a naturally occurring metabolite of NAD+ capable of mobilizing Ca2+ ions from intracellular stores. It was firstly isolated from sea urchin egg extract, but it was later established that it is also produced in many other mammalian cells, including pancreatic β-cells, T-lymphocytes, smooth and cardiac muscle cells, and cerebellar neurons, acting as a Ca2+-mobilizing agent. For this activity, cADPR has been classified as a second messenger that, by activating the ryanodine receptors of the sarcoplasmatic reticulum, is able to mobilize the calcium ions from intracellular stores. cADPR is involved in many physiological processes related to variation in the Ca2+ concentration, such as synaptic homeostasis in neurons as well as fertilization and cellular proliferation. This cyclic nucleotide, characterized by a very labile glycosidic bond at N1, is also rapidly hydrolysed in neutral aqueous solutions to inactive ADP-ribose. Matsuda and co-workers [1] were the first to synthesize new analogues of cADPR in which the adenine base is replaced by a hypoxanthine ring. This kind of modification produced the cyclic inosine diphosphate ribose (cIDPR), which proved to be stable in hydrolytic physiological conditions and showed significant Ca2+ mobilizing activity. Many modifications regarding the northern and southern ribose, as well as the purine base of cADPR, have been proposed so far. In our laboratories, we have synthesized several analogues of cIDPR [2–7]. In particular, the analogue with the northern ribose replaced by a pentyl chain (cpIDP) showed interesting Ca2+ mobilizing activity on the neuronal PC12 cell line [2]. Starting from these results, we report here the synthesis of the novel analogue 2, in which the “northern” ribose of cIDPR is replaced by a 2″,3″-dihydroxy pentyl chain. The effect of the presence of the diol moiety on the intracellular Ca2+ release will be assessed in due course

On the evolution of the Gamma- and X-ray luminosities of Pulsar Wind Nebulae

Pulsar wind nebulae are a prominent class of very high energy (E > 0.1 TeV) Galactic sources. Their Gamma-ray spectra are interpreted as due to inverse Compton scattering of ultrarelativistic electrons on the ambient photons, whereas the X-ray spectra are due to synchrotron emission. We investigate the relation between the Gamma- and-X-ray emission and the pulsars' spin-down luminosity and characteristic age. We find that the distance-independent Gamma- to X-ray flux ratio of the nebulae is inversely proportional to the spin-down luminosity, (\propto \dot{E}^-1.9), while it appears proportional to the characteristic age, (\propto tau_c^2.2), of the parent pulsar. We interpret these results as due to the evolution of the electron energy distribution and the nebular dynamics, supporting the idea of so-called relic pulsar wind nebulae. These empirical relations provide a new tool to classify unidentified diffuse Gamma-ray sources and to estimate the spin-down luminosity and characteristic age of rotation powered pulsars with no detected pulsation from the X- and Gamma-ray properties of the associated pulsar wind nebulae. We apply these relations to predict the spin-down luminosity and characteristic age of four (so far unpulsing) candidate pulsars associated to wind nebulae.Comment: Accepted for publication in ApJ (6 pages, 2 figures

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1′-uracilyl)-2-propanone on Serum Albumin Structure

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δβ-turn + Δβ-sheet = +23.6%, Δα = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the β-structure are consistent with a partial protein destabilization due to the interaction with U2O

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations

PNA-based graphene oxide/porous silicon hybrid biosensor: towards a label-free optical assay for Brugada Syndrome

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS). A functionalization strategy towards the realization of a potential PNA-based device is described. A peptide nucleic acid (PNA), able to detect the SCN5A associated with the BS has been properly synthesized and used as a bioprobe for the realization of a proof-of-concept label-free optical PNA-biosensor. PSi reflectance and GO photoluminescence (PL) signals were simultaneously exploited for the monitoring of the device functionalization and response

Heterotriplex-forming PNA in the targeting of the Bcl-2 P1 promoter in anticancer treatment

n/

ZnO Tetrapods for Label-Free Optical Biosensing: Physicochemical Characterization and Functionalization Strategies

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (–OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures’ suitability for biosensing applications

Bioconjugation of a PNA Probe to Zinc Oxide Nanowires for Label-Free Sensing

Zinc oxide nanowires (ZnONWs) are largely used in biosensing applications due to their large specific surface area, photoluminescence emission and electron mobility. In this work, the surfaces of ZnONWs are modified by covalent bioconjugation of a peptidic nucleic acid (PNA) probe whose sequence is properly chosen to recognize a complementary DNA (cDNA) strand corresponding to a tract of the CD5 mRNA, the main prognostic marker of chronic lymphatic leukemia. The interaction between PNA and cDNA is preliminarily investigated in solution by circular dichroism, CD melting, and polyacrylamide gel electrophoresis. After the immobilization of the PNA probe on the ZnONW surface, we demonstrate the ability of the PNA-functionalized ZnONW platform to detect cDNA in the μM range of concentration by electrical, label-free measurements. The specificity of the sensor is also verified against a non-complementary DNA sequence. These preliminary results highlight the potential application of PNA-bioconjugated ZnONWs to label-free biosensing of tumor markers